View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_low_32 (Length: 286)
Name: NF15938_low_32
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_low_32 |
 | |
|
| [»] scaffold0154 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0154 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 64 - 271
Target Start/End: Complemental strand, 3101 - 2895
Alignment:
| Q |
64 |
ttagttgtgaaaattttaaagacacaattgaaggcacttcggaagataaagaattgtgttgcatttgtcaggtgagctcgggctatttttaataatcatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3101 |
ttagttgtgaaaattttaaagacacaattgaaggcacttcggaagataaagaattgtgttgcatttgtcaggtgagctcgggctatttttaataatcatt |
3002 |
T |
|
| Q |
164 |
tgaggataacacgacaatgagttttagtagattagttaaacgcatgaaacattttatagtggtagttgtagaaaatagtttatttctttatattattgcc |
263 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3001 |
tg-ggataacacgacaatgagttttagtagattagttaaacacatgaaacattttatagtgatagttgtagaaaatagtttatttctttatattattgcc |
2903 |
T |
|
| Q |
264 |
attgttat |
271 |
Q |
| |
|
|||||||| |
|
|
| T |
2902 |
attgttat |
2895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University