View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_low_43 (Length: 239)
Name: NF15938_low_43
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 20526094 - 20526298
Alignment:
| Q |
16 |
atgggagtaatgggactaataagtgcttcaactcttcaagacggtgctttcaactttccattagtcgaacatagtataaaagtaaatcgatttgttttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526094 |
atgggagtaatgggactaataagtgcttcaactcttcaagacggtgctttcaactttccattagtcgaacatagtataaaagtaaatcgatttgttttgt |
20526193 |
T |
 |
| Q |
116 |
tattgctaatgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaagga |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526194 |
tattgctagtgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaagga |
20526293 |
T |
 |
| Q |
216 |
gagtt |
220 |
Q |
| |
|
||||| |
|
|
| T |
20526294 |
gagtt |
20526298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University