View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1593_low_10 (Length: 212)
Name: NF1593_low_10
Description: NF1593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1593_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 82 - 160
Target Start/End: Complemental strand, 39189381 - 39189303
Alignment:
| Q |
82 |
gagaaaaaactggtaattattttttcttttctatcatgttactctaaaaattgatagaaaattattaaagtaaatattt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39189381 |
gagaaaaaactggtaattattttttcttttctatcatgttactctaaaaattgatagaaaattattaaagtaaatattt |
39189303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 39190963 - 39190880
Alignment:
| Q |
1 |
ttgaaaaattgttcacttttataatagnnnnnnn-tatcatggttgattgtcatcaacccatcatatcgcatgatttggtcagagaaaaaac |
91 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39190963 |
ttgaaaaattgttcacttttataatagaaaaaaaatatcatggttgattgtcatca--------tatcgcatgatttggtcagagaaaaaac |
39190880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University