View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1593_low_10 (Length: 212)

Name: NF1593_low_10
Description: NF1593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1593_low_10
NF1593_low_10
[»] chr4 (2 HSPs)
chr4 (82-160)||(39189303-39189381)
chr4 (1-91)||(39190880-39190963)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 82 - 160
Target Start/End: Complemental strand, 39189381 - 39189303
Alignment:
82 gagaaaaaactggtaattattttttcttttctatcatgttactctaaaaattgatagaaaattattaaagtaaatattt 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39189381 gagaaaaaactggtaattattttttcttttctatcatgttactctaaaaattgatagaaaattattaaagtaaatattt 39189303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 39190963 - 39190880
Alignment:
1 ttgaaaaattgttcacttttataatagnnnnnnn-tatcatggttgattgtcatcaacccatcatatcgcatgatttggtcagagaaaaaac 91  Q
    |||||||||||||||||||||||||||        |||||||||||||||||||||        ||||||||||||||||||||||||||||    
39190963 ttgaaaaattgttcacttttataatagaaaaaaaatatcatggttgattgtcatca--------tatcgcatgatttggtcagagaaaaaac 39190880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University