View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1593_low_12 (Length: 207)
Name: NF1593_low_12
Description: NF1593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1593_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 17055273 - 17055452
Alignment:
| Q |
12 |
agatgaaacaatagttgaacctcgtgcaagttcatagttaattcggttgaatcgtctgctttggttaggtttttaaaacactgcgcaattcatttatggt |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17055273 |
agatgaaacaatagttgaacctcgtgcgagttcataattaattcggttgaatcgtctgctttggttaggtttttaaaacactgcgcaattcatttatggt |
17055372 |
T |
|
| Q |
112 |
tacccactaggttatgccattggcaagcagggaacgggcagggctaaagcagttggtattg-aaatttgacgatcatgag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17055373 |
tacccactaggttatgccattggcaagcagggaacgggcagggctaaagcagttggtattgaaaatttgacgatcatgag |
17055452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 120 - 177
Target Start/End: Original strand, 22595131 - 22595188
Alignment:
| Q |
120 |
aggttatgccattggcaagcagggaacgggcagggctaaagcagttggtattgaaatt |
177 |
Q |
| |
|
||||| |||| |||||||||||||| ||||||||||| || |||| || ||||||||| |
|
|
| T |
22595131 |
aggttctgcccttggcaagcagggatcgggcagggctgaaccagtcggaattgaaatt |
22595188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University