View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1593_low_8 (Length: 251)
Name: NF1593_low_8
Description: NF1593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1593_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 39191260 - 39191488
Alignment:
| Q |
13 |
aggtccagtgatcatatatttttaagagtttat--gattgttgtagcatgctagaaaattgagannnnnnnnnnnagtatttggttgacatatagatgac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39191260 |
aggtccagtgatcatatatttttaagagtttatatgattgttgtagcatgttagaaaattgagattttattttttagtatttggttgacatatagatgac |
39191359 |
T |
|
| Q |
111 |
acttgccattattgatgcaatataacattcgaaaagagttggtgaaaatagttgaccgtggttagagaatttcgataatatgtacgtatttgaatgtcaa |
210 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39191360 |
acttgtcattatcgatgcaatataacattcgaaaagagttggagaaaatagtcgaccgtggttagagaatttcgataatatgtacgtatttgaatgtcaa |
39191459 |
T |
|
| Q |
211 |
agaatgcaaacaaagtatagtagaataat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39191460 |
agaatgcaaacaaagtatagtagaataat |
39191488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University