View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1594-INSERTION-28 (Length: 500)
Name: NF1594-INSERTION-28
Description: NF1594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1594-INSERTION-28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 4e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 7349040 - 7348956
Alignment:
| Q |
132 |
ttccccatgacgaagaaggatgtgaag----actgttgaagatatgttagaggatgctgatttcaaaactcgtctaaaatggcat |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7349040 |
ttccccatgacgaagaaggatgtgaaggtacactgttgaagatatgttagaggatgctgatttcaaaactcgtctaaaatggcat |
7348956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 7349082 - 7349042
Alignment:
| Q |
68 |
aaaatttaagtggctggggattaggccaacggatattatgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7349082 |
aaaatttaagtggctggggattaggccaactgatattatgg |
7349042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University