View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15940_high_20 (Length: 302)
Name: NF15940_high_20
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15940_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 47518266 - 47518474
Alignment:
| Q |
18 |
acaatatacatagagggaatcaagtacaaatgtatttctta-tatttaagcttaagcctaactcaatcccaaatactagctcgtgaactgagcttttccc |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47518266 |
acaatatacatagagagaatcaagtacaaatgtatttcttagtatttaagcttaagcctaactcaatcccaaatactagctcgtgaactgagcttttccc |
47518365 |
T |
|
| Q |
117 |
ccctcttattgctactgtttagaccatatcattattccgtgtggactgtcaacaatatctataaatcaagaagcgagctgtaacttattttggaacaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47518366 |
ccctcttattgctactgtttagaccatatcattatcccctgtggactgtcaacaatatctataaatcaagaagcgagctgtaacttattttggaacaaaa |
47518465 |
T |
|
| Q |
217 |
gtgagttat |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
47518466 |
gtgagttat |
47518474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University