View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15940_high_28 (Length: 245)

Name: NF15940_high_28
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15940_high_28
NF15940_high_28
[»] chr4 (2 HSPs)
chr4 (171-231)||(32776815-32776875)
chr4 (14-54)||(32776649-32776689)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 32776815 - 32776875
Alignment:
171 acacgagaggggcgattcccctctttatttatatccctcttacagttttaaatgagttatc 231  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
32776815 acacgagaggggtgattcccctctttatttatatccctcttacagttttaaatgagttatc 32776875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 32776649 - 32776689
Alignment:
14 ataattctcaaactctcattcaacggaaagagattctctca 54  Q
    |||||||||||||| ||||||||||| ||||||||||||||    
32776649 ataattctcaaactgtcattcaacgggaagagattctctca 32776689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University