View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15940_high_31 (Length: 237)
Name: NF15940_high_31
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15940_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 80 - 156
Target Start/End: Original strand, 26570431 - 26570507
Alignment:
| Q |
80 |
gtgtgtcattatataaaacaaaagaagaagaacgagaatttatggaagcgggcctaaatgactttaaatggaagcaa |
156 |
Q |
| |
|
|||||||||||||| ||||||||| | || || |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26570431 |
gtgtgtcattatatgaaacaaaagcaaaacaatgagaatttatggaagcgggcctaaatgactttaaatagaagcaa |
26570507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 152 - 216
Target Start/End: Original strand, 26570553 - 26570617
Alignment:
| Q |
152 |
agcaagtaagcatgcatgggttaatctttatgcatgcatgatgttgtactagagttctactatat |
216 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26570553 |
agcaagtaggcatgcatgggtcagtctttatgcatgcatgatattgtactagagttctactatat |
26570617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University