View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15940_high_35 (Length: 207)
Name: NF15940_high_35
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15940_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 31930708 - 31930886
Alignment:
| Q |
12 |
gagatgaagaaacagttcttctccagttttgtaaagtaggaggtgatactttcaccatgtactatagacagcccttatccgccttccatgcgttcgccat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31930708 |
gagatgaagaaacagttcttctccagttttgtaaagtaggaggtgatactttcaccatgtactatagacagcccttatccgccttccatgcgttcgccat |
31930807 |
T |
|
| Q |
112 |
ttgcttaactagcttcggcaccaaactggcttgtcagtaagatcattttggtatcattctactgcttgttcattccttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31930808 |
ttgcttaactagcttcggcaccaaactggcttgtcagtaagataattttggtatcattctactgcttgttcattccttt |
31930886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 12 - 169
Target Start/End: Original strand, 31927135 - 31927292
Alignment:
| Q |
12 |
gagatgaagaaacagttcttctccagttttgtaaagtaggaggtgatactttcaccatgtactatagacagcccttatccgccttccatgcgttcgccat |
111 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||||||| | ||||| ||||||||| ||||||| |||||||| ||||||||||| ||||| ||||| |
|
|
| T |
31927135 |
gagatgaagaaacggttctcctccagtttggtaaagtaggggacgataccttcaccatggactataggcagcccttgtccgccttccaggcgtttgccat |
31927234 |
T |
|
| Q |
112 |
ttgcttaactagcttcggcaccaaactggcttgtcagtaagatcattttggtatcatt |
169 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
31927235 |
ttgcctaactagctttggcactaaactggcttgtgagtaatataattttagtatcatt |
31927292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University