View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15940_low_32 (Length: 245)
Name: NF15940_low_32
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15940_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 32776815 - 32776875
Alignment:
| Q |
171 |
acacgagaggggcgattcccctctttatttatatccctcttacagttttaaatgagttatc |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32776815 |
acacgagaggggtgattcccctctttatttatatccctcttacagttttaaatgagttatc |
32776875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 32776649 - 32776689
Alignment:
| Q |
14 |
ataattctcaaactctcattcaacggaaagagattctctca |
54 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32776649 |
ataattctcaaactgtcattcaacgggaagagattctctca |
32776689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University