View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15940_low_41 (Length: 201)
Name: NF15940_low_41
Description: NF15940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15940_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 34630139 - 34629973
Alignment:
| Q |
17 |
gaaggggccagtgctcttgtagatttgtgcaaggcgtttatatctgcttttgacagtttgataagcacagatgggtaagaaaaccatttctcaggatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630139 |
gaaggggccagtgctcttgtagatttgtgcgaggcgtttatatctgcttttgacagtttgataagcacagatgggtaagaaaaccatttctcaggatttt |
34630040 |
T |
|
| Q |
117 |
aacttttaaatcgcttgcttggttttgcatctatctttgtctgatttgggatattatggcttgttct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630039 |
aacttttaaatcgcttgcttggttttgcatctatctttgtctgatttgggatattatggcttgttct |
34629973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 25 - 140
Target Start/End: Complemental strand, 14298857 - 14298744
Alignment:
| Q |
25 |
cagtgctcttgtagatttgtgcaaggcgtttatatctgcttttgacagtttgataagcacagatgggtaagaaaaccatttctcaggattttaactttta |
124 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
14298857 |
cagtgctcttgtagatttgtgccgggagtttatatctacttttgagagtttgagaagcacagatgggtaagaaaaccatttctcaggattataac--gta |
14298760 |
T |
|
| Q |
125 |
aatcgcttgcttggtt |
140 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
14298759 |
aatcgcttccttggtt |
14298744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University