View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_110 (Length: 310)
Name: NF15941_high_110
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 41342268 - 41342404
Alignment:
| Q |
7 |
gtagcataggtggttgccgtcagaagatctaattggtcctgatggtgccattatgtccataccatgactcccagcataatataaattatttaacttcaca |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342268 |
gtagcattggtggttgccgtcagaagatctaattggtcctgatggtgccattatgtccataccatgactcccagcataatataaattatttaacttcaca |
41342367 |
T |
 |
| Q |
107 |
aaatcttttacctaaaccaaaaagttatataatgaga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342368 |
aaatcttttacctaaaccaaaaagttatataatgaga |
41342404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 180 - 294
Target Start/End: Original strand, 41342449 - 41342563
Alignment:
| Q |
180 |
aaattaagtaagctttataactcaccttctctcggcttcttccactgattattgctgttggaaaataagtagcaacttcagatactgctgcacgcatctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342449 |
aaattaagtaagctttataactcaccttctctcggcttcttccactgattattgctgttggaaaataagtagcaacttcagatactgctgcacgcatctg |
41342548 |
T |
 |
| Q |
280 |
ccatttatttgtatt |
294 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41342549 |
ccatttatttgtatt |
41342563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University