View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_high_132 (Length: 285)

Name: NF15941_high_132
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_high_132
NF15941_high_132
[»] chr7 (1 HSPs)
chr7 (12-268)||(43568275-43568531)


Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 12 - 268
Target Start/End: Complemental strand, 43568531 - 43568275
Alignment:
12 atgaaagagaaggatgtaattagttggacaagtttgatttctggagtagctatgcatggttatgcagaggaagcgcttgagtatttttatgtaatggtga 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43568531 atgaaagagaaggatgtaattagttggacaagtttgatttctggagtagctatgcatggttatgcagaggaagcgcttgagtatttttatgtaatggtga 43568432  T
112 aaaatgggatagttcctagagatattacttttacagcggttttgaaagcttatagtcatggagggctggtagaaaagggtcaagaaatatttgaaagcat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43568431 aaaatgggatagttcctagagatattacttttacagcggttttgaaagcttatagtcatggagggctggtagaaaagggtcaagaaatatttgaaagcat 43568332  T
212 gaaaagggattataggttagagccgagattggaacattatggatgtatggttgatct 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43568331 gaaaagggattataggttagagccgagattggaacattatggatgtatggttgatct 43568275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University