View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_134 (Length: 284)
Name: NF15941_high_134
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 24996078 - 24995915
Alignment:
| Q |
20 |
catacgggacatgaaattgacatgaacatgtcaacactgatttttt---gtttgttcagaaaataacataatttattgtaattgcaagtgtcgatgttgt |
116 |
Q |
| |
|
||||| ||||| || ||||||| |||||||||||||| |||||||| ||||||| |||||||||||||||| |||||||| |||||| ||| ||| || |
|
|
| T |
24996078 |
catacaggacacgacattgacacgaacatgtcaacaccgatttttttttgtttgtttagaaaataacataattcattgtaatcgcaagtatcggtgtcgt |
24995979 |
T |
 |
| Q |
117 |
gtttatgttgaacaaaacacatgtcgaacatcggaacacgctttcaattgggtttcgtctttct |
180 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24995978 |
gtctatgttgaacaagacacatgtcgaacatcggaacacactttcaattgggtttcgtctttct |
24995915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 24995886 - 24995854
Alignment:
| Q |
209 |
ttcatggtgaggtgggttggcggtgtagtttct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24995886 |
ttcatggtgaggtgggttggcggtgtagtttct |
24995854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 243 - 274
Target Start/End: Complemental strand, 24994395 - 24994364
Alignment:
| Q |
243 |
tccaaaaatttaattcaattcacccctttcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24994395 |
tccaaaaatttaattcaattcacccctttcat |
24994364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 239
Target Start/End: Original strand, 9519148 - 9519178
Alignment:
| Q |
209 |
ttcatggtgaggtgggttggcggtgtagttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9519148 |
ttcatggtgaggtgggttggcggtgtagttt |
9519178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 43243098 - 43243157
Alignment:
| Q |
77 |
aaataacataatttattgtaattgcaagtgtcgatgttgtgtttatgttgaacaaaacac |
136 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |||||| ||| ||||| ||||| |
|
|
| T |
43243098 |
aaataacataatttaatgtaattacaagtgtcgatgtcgtgtttgtgtcgaacacaacac |
43243157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 31586255 - 31586223
Alignment:
| Q |
209 |
ttcatggtgaggtgggttggcggtgtagtttct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31586255 |
ttcatggtgaggtgggttggcggtgtagtttct |
31586223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 243 - 274
Target Start/End: Original strand, 53687310 - 53687341
Alignment:
| Q |
243 |
tccaaaaatttaattcaattcacccctttcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53687310 |
tccaaaaatttaattcaattcacccctttcat |
53687341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University