View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_140 (Length: 278)
Name: NF15941_high_140
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_140 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 43174666 - 43174908
Alignment:
| Q |
19 |
atggttatatattttacaggggccacagacactcgtgtattttctctggactaagcactagtttctcgtttttactagtatactctcatgttgtcatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43174666 |
atggttatatattttacaggggccacagacactcgtgtattttctctggacttagcactagtttctcatttttacttgtatactctcatgttgtcatgtt |
43174765 |
T |
 |
| Q |
119 |
gcatatggttttattggttttattgccatgttatatatgatatttctactgttacatttggcttttgattttactagttttgttttaaatatgttgggtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174766 |
gcatatggttttattggttttattgccatgttatttatgatatttttactgttacatttggcttttgattttactagttttgttttaaatatgttgggtc |
43174865 |
T |
 |
| Q |
219 |
gttttgtatagagtatgttgcacttggatatattatgcaaaat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174866 |
gttttgtatagagtatgttgcacttggatatattatgcaaaat |
43174908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University