View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_146 (Length: 266)
Name: NF15941_high_146
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_146 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 30666797 - 30666551
Alignment:
| Q |
1 |
cggctagcgcaacaactccaattggcagaactgaatgtggttcgtaaccaaaaactgcatcaaagtacaaactgttgttaacataagtgcaaatgataga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30666797 |
cggctagcgcaacaactccaattggcagaactgaatgtggttcgtaaccaaaaactgcatcaaagtacaaactgttgttaacataagtgcaaatgataga |
30666698 |
T |
 |
| Q |
101 |
agcatttgatgtggaacacaaaaagaccctaaaaaattgaaaattgaattaacattaatactagttagtttggtagaaagaacgaaccataagcacgatt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30666697 |
agcatttgatgttgaacacaaaaagaccctaaaaaattgaaaattgaattaacattaatactagttagtttagtagaaagaacgaaccataagcacgatt |
30666598 |
T |
 |
| Q |
201 |
tggatggaaagcctttatatcctctacatgaagcgtgacagggaagt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30666597 |
tggatggaaagcctttatatcctctacatgaagcgtgacagggaagt |
30666551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 60
Target Start/End: Original strand, 10112915 - 10112972
Alignment:
| Q |
3 |
gctagcgcaacaactccaattggcagaactgaatgtggttcgtaaccaaaaactgcat |
60 |
Q |
| |
|
||||| |||| ||| |||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
10112915 |
gctagtgcaataacgccaattggcaaaactgaatgtggttcataaccaaaaactgcat |
10112972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 10114122 - 10114181
Alignment:
| Q |
177 |
aaagaacgaaccataagcacgatttggatggaaagcctttatatcctctacatgaagcgt |
236 |
Q |
| |
|
||||||| |||||||||||||||| |||| || || ||||||||||||||||||||||| |
|
|
| T |
10114122 |
aaagaacaaaccataagcacgattaggatcaaatgcttttatatcctctacatgaagcgt |
10114181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University