View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_175 (Length: 246)
Name: NF15941_high_175
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_175 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 963323 - 963146
Alignment:
| Q |
1 |
tgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcactccaacaacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
963323 |
tgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcactccagcaacttc |
963224 |
T |
|
| Q |
101 |
tccttcttctccatattctgcaacctgtttggaacaaatattaccttgatcagtccatatatcaaactgtgaaactact |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
963223 |
tccttcttcttcatattctgcaacctgtttggaacaaatattacattgattagtcca-atatcaaactgtgaaactact |
963146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 188 - 226
Target Start/End: Complemental strand, 963056 - 963018
Alignment:
| Q |
188 |
tattcaacactaaaacataatgtcgcattaggtatacat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
963056 |
tattcaacactaaaacataatgtcgcattagatatacat |
963018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University