View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_187 (Length: 236)
Name: NF15941_high_187
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_187 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 10520347 - 10520549
Alignment:
| Q |
18 |
gagtggggtgggaagaatgagaagtggtggaggtgtagtagtagcggaggcgctgtaaggagtatttcgagaaacgagccatgtttgaaggtggaagatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10520347 |
gagtggggtgggaagaatgagaagtggtggaggtgtagtagtagcggaggcgctgtaaggagcatttcgagaaacgagccatgtttgaaggtggaagatg |
10520446 |
T |
|
| Q |
118 |
gatgggtaaaaccctt-ggggtgggtttatagctttgatgctaaatcgtactatcatcatcatcatcgttattttccgtactacactcattttcccgctt |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10520447 |
gatgggtaaaacccttgggggtgggtttatagatttgatgctaaatcgt--catcatcatcatcatcgttattttccgtactacactcattttcccgctt |
10520544 |
T |
|
| Q |
217 |
cttct |
221 |
Q |
| |
|
||||| |
|
|
| T |
10520545 |
cttct |
10520549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University