View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_194 (Length: 234)
Name: NF15941_high_194
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_194 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 16 - 113
Target Start/End: Complemental strand, 27315106 - 27315009
Alignment:
| Q |
16 |
gagatgtggaggatagcctcgtcgcaccaccctaccttgaggctgcatcgggnnnnnnngattggattgtgaggtgaaggggtggcggttggttgctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27315106 |
gagatgtggaggatagcctcgtcgcaccaccctaccttgaggctgcatcgggaaaaaaagattggattgtgaggtgaaggggtggcggttggttgctc |
27315009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 151 - 219
Target Start/End: Complemental strand, 27314971 - 27314903
Alignment:
| Q |
151 |
agtagtaattctcgagtatcgtctcatatgcaatgactataaacaaatcatgaggtcaatcccttgata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27314971 |
agtagtaattctcgagtatcgtctcatatgcaatgactataaacaaatcatgaggtcaatcccttgata |
27314903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University