View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_203 (Length: 227)
Name: NF15941_high_203
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_203 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 29 - 227
Target Start/End: Complemental strand, 34381319 - 34381121
Alignment:
| Q |
29 |
ttgtgaacatcacttacacaaataaacagataaattaagtccagtgttctacttctcttttgttttccacggtagagagggtttaccctagaaaacagaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381319 |
ttgtgaacatcacttacacaaataaacagataaattaagtccagtgttctacttctcttttgttttccacggtagagagggtttaccctagaaaacagaa |
34381220 |
T |
 |
| Q |
129 |
gaggggtcgtacatttgcctcgatcatctgcttaccttgttgtgctagtgattgttgtgacttcgcaactataaacttgattactcttccgaatcatat |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381219 |
gaggagtcgtacatttgcctcgatcatctgcttaccttgttgtgctagtcattgttgtgacctcgcaactataaacttgattactcttccgaatcatat |
34381121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University