View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_208 (Length: 222)
Name: NF15941_high_208
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_208 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 33743007 - 33743223
Alignment:
| Q |
1 |
ctttttgtggacatattttcttggtgtaaattattagtcaaatgatcaccaatggaagttaaactcggtgaaatgtgttagactgatacaatgtgacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33743007 |
ctttttgtggacatattttcttggtgtaaattattagtcaaatgatcaccaatggaagttaaactcggtgaaatgtgttagactgttacaatgtgacaaa |
33743106 |
T |
 |
| Q |
101 |
ctaaaatccaaattttgattgaaagatgtgtccttcgcatagcaatctcatcaggcgcggtgtgccgcttcctgtcgatgggatgaggtgtctcttctgc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
33743107 |
ctaaaatccgaattttgattgaaagatgtgtccttcgcataacaatctcatcaggcgcggtgtgccgcttcctgtcgatgggatggggtgtgtcttctgc |
33743206 |
T |
 |
| Q |
201 |
gacgggccgtctgagtc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33743207 |
gacgggccgtctgagtc |
33743223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 202
Target Start/End: Original strand, 4777719 - 4777779
Alignment:
| Q |
142 |
gcaatctcatcaggcgcggtgtgccgcttcctgtcgatgggatgaggtgtctcttctgcga |
202 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| | |||| || ||||| ||||||||| |
|
|
| T |
4777719 |
gcaatctcattaggcgcggtgtgcctcttcctgtaggtggggtggggtgtgccttctgcga |
4777779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University