View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_high_31 (Length: 458)

Name: NF15941_high_31
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_high_31
NF15941_high_31
[»] chr3 (1 HSPs)
chr3 (340-442)||(24084553-24084655)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 340 - 442
Target Start/End: Complemental strand, 24084655 - 24084553
Alignment:
340 tatcttaatagagggtgagattcatcagagtgaaattgaagagatagttggatatggagatgaagtggaagagaatgagatacttgaagttgaggatgga 439  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |    
24084655 tatcttaatagagggtgagactcatgagagtgaaattgaagagatagttggagatggagatgaaatggaagagaatgagatacttgaagttgaggatgaa 24084556  T
440 cta 442  Q
    |||    
24084555 cta 24084553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University