View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_34 (Length: 452)
Name: NF15941_high_34
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 15 - 436
Target Start/End: Complemental strand, 37267264 - 37266842
Alignment:
| Q |
15 |
atgaaggaaggggtattggattgggccacaagcttcgtgcgtataacctacaggatgagggaagggatactgtagaagccaatgaggagttgggattgcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37267264 |
atgaaggaaggggtattggattgggccacaagcttcgtgcgtataacctacaggatgagggaagggatactgtagaagccaatgaggagttgggattgcc |
37267165 |
T |
 |
| Q |
115 |
tgttgactcaagggagtatggaattggtgcacaggtaattataataaaaataaa-taattagtcacttgaatattgaacatcttatcctcaattatttta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37267164 |
tgttgactcaagggagtatggaattggtgcacaggtaattataataaaaataaaataattagtcacttgaatattgaacatcttatcctcaattatttta |
37267065 |
T |
 |
| Q |
214 |
ctgtattcaattcatggtgatttacatgattattaagttcaatgacatgctattgtccatacaacatagaactagatgttttgggcagttggattcactc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37267064 |
ctgtattcaattcatggtgatttacatgattattaagttcaatgacatgctattgtccatacaacatagaactagatgttttgggcagttggattcactc |
37266965 |
T |
 |
| Q |
314 |
ataatggttagaatttgaaattgtaattgcagatattgagggacttgggtgttcgttctatgaagctgatgacaaacaatccggcaaaatatgttgggct |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37266964 |
ataatggttagaatttgaaattgtaattgcagatattgagggacttgggtgttcgttctatgaagctgatgacaaacaatccagcaaaatatgttgggct |
37266865 |
T |
 |
| Q |
414 |
caaaggttatggtttgtcgattt |
436 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37266864 |
caaaggttatggtttgtcgattt |
37266842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 2e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 15 - 153
Target Start/End: Original strand, 1851426 - 1851564
Alignment:
| Q |
15 |
atgaaggaaggggtattggattgggccacaagcttcgtgcgtataacctacaggatgagggaagggatactgtagaagccaatgaggagttgggattgcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||| ||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1851426 |
atgaaggaaggggtattggattgggccacaagctccgtgcttataacttacaggatgatggacgcgataccgtagaagccaatgaggagttgggattgcc |
1851525 |
T |
 |
| Q |
115 |
tgttgactcaagggagtatggaattggtgcacaggtaat |
153 |
Q |
| |
|
||||||||| || || ||||| || || ||||||||||| |
|
|
| T |
1851526 |
tgttgactctagagaatatggcataggcgcacaggtaat |
1851564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 340 - 429
Target Start/End: Original strand, 1851937 - 1852026
Alignment:
| Q |
340 |
ttgcagatattgagggacttgggtgttcgttctatgaagctgatgacaaacaatccggcaaaatatgttgggctcaaaggttatggtttg |
429 |
Q |
| |
|
||||||||| ||||||| | ||||||| ||||||||| |||||||||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
1851937 |
ttgcagatactgagggatctaggtgttcaatctatgaagttgatgacaaacaatccaacaaaatatgttggcctcaaaggctatggtttg |
1852026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 428
Target Start/End: Original strand, 41152694 - 41152782
Alignment:
| Q |
340 |
ttgcagatattgagggacttgggtgttcgttctatgaagctgatgacaaacaatccggcaaaatatgttgggctcaaaggttatggttt |
428 |
Q |
| |
|
|||||||| ||||||||| | || ||||| |||||| | |||||||||||||||| ||||||| |||||| || ||||| |||||||| |
|
|
| T |
41152694 |
ttgcagattttgagggacattggagttcgaactatgaggttgatgacaaacaatccagcaaaatttgttggtcttaaaggatatggttt |
41152782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University