View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_51 (Length: 415)
Name: NF15941_high_51
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 6 - 399
Target Start/End: Original strand, 44779426 - 44779819
Alignment:
| Q |
6 |
aagcataggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatgcgaaag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44779426 |
aagcataggtgatgcaaagaaattttctcaacaattgttgaaagcaaaaaataccattgcaaaattattagtgtcatttgtgtgatgccgaatacgaaag |
44779525 |
T |
|
| Q |
106 |
aatgaaacagataacggtgtttatggtaagttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtggggaacataagtgagggttac |
205 |
Q |
| |
|
||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44779526 |
aattaaacatataacggtgtttatggta-gttaaaaaatcaaataaaagggattgtgttaaatttctcaaaaattggtgggggacataagtgagggttat |
44779624 |
T |
|
| Q |
206 |
cagtgaaataagatataatatgttctactttatccaaacagcgaaacataaatttattctattccattaatctaaacatatctgaaagatattaaaggaa |
305 |
Q |
| |
|
| ||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44779625 |
cggtgaaataaaatataatatattccactttatccaaacagcgaaacataaatttattctattccattaatttaaacatatctgaaagatattaaaggaa |
44779724 |
T |
|
| Q |
306 |
aatattataagaactnnnnnnntacga-nnnnnnnngcagggttcgaaaacaaaaatctatgtgtttatagttactattttcttaattaaccctg |
399 |
Q |
| |
|
||| ||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44779725 |
aatgttataagaactaaaaaaatacgattttttttttcagggttcgaaaacaaaaatctatgtatttatagttactattttcttaattaaccctg |
44779819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University