View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_high_78 (Length: 350)
Name: NF15941_high_78
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_high_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 16 - 334
Target Start/End: Complemental strand, 38685062 - 38684744
Alignment:
| Q |
16 |
tttgtggagaggggagagagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38685062 |
tttgtggagaggggagagagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatg |
38684963 |
T |
|
| Q |
116 |
cggtggtgatgggattggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684962 |
cggtggtgatgggattggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatga |
38684863 |
T |
|
| Q |
216 |
tgattgtggttctcctttggttttcatgcttgatgtcaatgagattttcaggtacttgctcattttgggtttggttaattaatttgttgctataagtatt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684862 |
tgattgtggttctcctttggttttcatgcttgatgtcaacgagattttcaggtacttgctcattttgggtttggttaattaatttgttgctataagtatt |
38684763 |
T |
|
| Q |
316 |
aagcacttctctgaatcat |
334 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38684762 |
aagcacttctctgaatcat |
38684744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University