View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_114 (Length: 311)
Name: NF15941_low_114
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 29 - 297
Target Start/End: Complemental strand, 47111963 - 47111688
Alignment:
| Q |
29 |
caaagttgtcacaaaatgaatgttcggatattatttctcatttatgaatgatggacatggtgtactcacgtaaacgcaatttatattttccacatgtttc |
128 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47111963 |
caaagttatcacaaa-tgaatgttcggatatcatttctcatttatgaatgatggacatggtgcactcacgaaaacgcaatttatattttccacatgtttc |
47111865 |
T |
|
| Q |
129 |
ttgaacttgcgctcatcattcttccccagatttct---tctttttggttgtcaagtcaccatcactgaccaaaatattttagtgggtaattcggttgcct |
225 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47111864 |
tttaacttgcgctcatcattcttccccagatttcttcttctttttggttgtcaagtcaccatcactgaccaaaatattttagtgggtaattcggttgcct |
47111765 |
T |
|
| Q |
226 |
tgaaatgagaggggg-----gatnnnnnnnngcaaacaaatcttacaatttaataagcaacaaggtatataaaaaat |
297 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
47111764 |
tgaaatgagagggggaaaaaaaaaaaaaaaagcaaacaaatcttacaattcaagaagcaacaaggtatataaaaaat |
47111688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 18336195 - 18336154
Alignment:
| Q |
30 |
aaagttgtcacaaaatgaatgttcggatattatttctcattt |
71 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
18336195 |
aaagttgtcacaaaatgaatgttcaaatatcatttctcattt |
18336154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University