View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_130 (Length: 297)
Name: NF15941_low_130
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_130 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 277
Target Start/End: Original strand, 45695430 - 45695689
Alignment:
| Q |
11 |
agcacagacaagaggtggtgccattcttccgtcttggatgattcgtcctataaatgaatagtagcagaaaaagataattacgtacatttgtagtattgta |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695430 |
agcacaaacaagaggtggtgccattcttccgtcttggatgattcgtcctataaatgaatagtagcagaaaaagataattacgtacatttgtagtattgta |
45695529 |
T |
 |
| Q |
111 |
ccacttttctttattcaaaacacaaaaacagcttgtaggaagcctatagatatagtatatcatcgatatagcctataggcatatgatggttgatgactca |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45695530 |
ccacttttctttattcaaaacccaaaaacagcttgtaggaagcctatagatatagtatatcatcga-------tataggcatatgatggttgatgactca |
45695622 |
T |
 |
| Q |
211 |
ctacctgcattgtaattgtgtaattatgtaacatgtctgactcaatttcattgttgctggaccggcc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45695623 |
ctacctgcattgtaattgtgtaattatgtaacatgtctgactcaattacattgttgctggaccggcc |
45695689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University