View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_138 (Length: 285)
Name: NF15941_low_138
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_138 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 5232054 - 5232310
Alignment:
| Q |
16 |
ttttctttttataaagcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaagagcacagaggtaaagaattttacattaa |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5232054 |
ttttcttttgataaagcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaagagcacagaggtaaagatttttacattaa |
5232153 |
T |
 |
| Q |
116 |
attttcatattttctatagtgaaatatttgccaatatatcgacactattaattgtgtgtgtatgtatgtgtctccaatatttcagaaatcttttaggtga |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5232154 |
-ttttcatattttttatagtgaaatatttgccaatatatcgacactattaattgtgtgtgta----tgtgtctccaatatttcagaaatcttttaggtga |
5232248 |
T |
 |
| Q |
216 |
agatttgggtccactaagttctaaggatcttgagcagcttgaaaggcaattggattcatctc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5232249 |
agatttgggtccactaagttctaaggatcttgagcagcttgaaaggcaattggattcatctc |
5232310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 5655796 - 5655853
Alignment:
| Q |
30 |
agcagagcagttaccgtgaatacttgaagctgaaacaaagatttgaaaatcttcaaag |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
5655796 |
agcagagcagttaccgtgagtacttgaagctgaaagcaagatttgaatctcttcaaag |
5655853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University