View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_139 (Length: 285)
Name: NF15941_low_139
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_139 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 12 - 268
Target Start/End: Complemental strand, 43568531 - 43568275
Alignment:
| Q |
12 |
atgaaagagaaggatgtaattagttggacaagtttgatttctggagtagctatgcatggttatgcagaggaagcgcttgagtatttttatgtaatggtga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568531 |
atgaaagagaaggatgtaattagttggacaagtttgatttctggagtagctatgcatggttatgcagaggaagcgcttgagtatttttatgtaatggtga |
43568432 |
T |
|
| Q |
112 |
aaaatgggatagttcctagagatattacttttacagcggttttgaaagcttatagtcatggagggctggtagaaaagggtcaagaaatatttgaaagcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568431 |
aaaatgggatagttcctagagatattacttttacagcggttttgaaagcttatagtcatggagggctggtagaaaagggtcaagaaatatttgaaagcat |
43568332 |
T |
|
| Q |
212 |
gaaaagggattataggttagagccgagattggaacattatggatgtatggttgatct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568331 |
gaaaagggattataggttagagccgagattggaacattatggatgtatggttgatct |
43568275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University