View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_144 (Length: 282)
Name: NF15941_low_144
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_144 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 176
Target Start/End: Complemental strand, 16923693 - 16923531
Alignment:
| Q |
14 |
gaatacgatgtatgcgatatcagtttttgtgttctccaatcatttctaaaaaatcgaaccatcacgatcaacaacccaccttaaatcaaacatctcgtca |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
16923693 |
gaatacgatgtgtgcgatatcagtttttgtattctccaatcatttctaaaaaatcgaaccatcaccatcaacaacccaccttaaatcaaacatctcatca |
16923594 |
T |
|
| Q |
114 |
accgtcaccaaacaatttttagataactcaaagtcatttgaatctaacacatagaggaccacc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16923593 |
accgtcaccaaacaatttttagataactcaaagtcatttgaatctaacacatagaggaccacc |
16923531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 201 - 282
Target Start/End: Complemental strand, 16923473 - 16923392
Alignment:
| Q |
201 |
caaattatcatcaaactaattattcaccttccaacccacacctcttcggataccaaccatatctttcgaccaagttgacccc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16923473 |
caaattatcatcaaactaattattcaccttcaaacccacacttcttcggataccaacaatatctttcgaccaagttgacccc |
16923392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University