View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_147 (Length: 280)
Name: NF15941_low_147
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_147 |
 | |
|
| [»] scaffold0341 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 35 - 258
Target Start/End: Original strand, 6496923 - 6497147
Alignment:
| Q |
35 |
taatactcaattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtat-ttacatgaatatgactgaaattaatccaacaact |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6496923 |
taatactcaattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtatattacatgaatatgactgaaattaatccaacaact |
6497022 |
T |
|
| Q |
134 |
accgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttgaaggtttctgctatccatatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497023 |
accgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttgaaggtttctgctatccatatg |
6497122 |
T |
|
| Q |
234 |
aaatgcaggttccaaaggcattggg |
258 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6497123 |
aaatgcaggttccaaaggcattggg |
6497147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 136 - 213
Target Start/End: Original strand, 6514384 - 6514461
Alignment:
| Q |
136 |
cgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttga |
213 |
Q |
| |
|
|||||| | |||| ||||||||||| ||||||||||||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
6514384 |
cgaggaaatagctgtgtatttgaagccccattgactgattcttgagcagaactatgacctgacgatttcatatcttga |
6514461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 258
Target Start/End: Original strand, 6510100 - 6510133
Alignment:
| Q |
225 |
atccatatgaaatgcaggttccaaaggcattggg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6510100 |
atccatatgaaatgcaggttccaaaggcattggg |
6510133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0341
Description:
Target: scaffold0341; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 258
Target Start/End: Original strand, 4124 - 4157
Alignment:
| Q |
225 |
atccatatgaaatgcaggttccaaaggcattggg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4124 |
atccatatgaaatgcaggttccaaaggcattggg |
4157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 258
Target Start/End: Original strand, 11780 - 11813
Alignment:
| Q |
225 |
atccatatgaaatgcaggttccaaaggcattggg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11780 |
atccatatgaaatgcaggttccaaaggcattggg |
11813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University