View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_150 (Length: 276)
Name: NF15941_low_150
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_150 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 268
Target Start/End: Complemental strand, 182739 - 182484
Alignment:
| Q |
16 |
aagaagaacatacaaggacactaaagccagtaacttcagcaaaagacatggcaatggaaacaccagagaatgaaacaagtataccaagatgtccaaccat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182739 |
aagaagaacatacaaggacactaaagccagtaacttcagcaaaagacatggcaatggaaacaccagagaatgaaacaagtataccaagatgtccaaccat |
182640 |
T |
|
| Q |
116 |
cataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgccacgaaactcactttcttcaactcttgaacaaatgtactc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182639 |
cataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgcaacgaaactcactttcttcaactcttgaacaaatgtactc |
182540 |
T |
|
| Q |
216 |
tcaatctc---atcattctttcttatcaatggtgttgtcacctccttattcatctc |
268 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
182539 |
tcaatctcatgatcactctttcttatcaatggtgttgtcacctccttactcatctc |
182484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University