View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_169 (Length: 256)
Name: NF15941_low_169
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_169 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 7887690 - 7887923
Alignment:
| Q |
20 |
atggaacactgccttttataagatagatgagtcagtgtctccctctgattcaggaaacggcaatgcgcaatgtaatgttgcat-----catttctttctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7887690 |
atggaacactgccttttataagatagatgagtcagtgtctcccactgattcaggaaacggcaatgcgcaatgtaatgttgcattgcatcatttctttctt |
7887789 |
T |
 |
| Q |
115 |
tattaactgtacnnnnnnntatcttaggttgataggattttttcaaaggtgaatttat--cctatttcttcgtttccaattcatgtattcttattatcga |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887790 |
tattaactgtacaaaaaaaaatcttaggttgataggattttttcaaagctgaatttatatcctatttcttcgtttccaattcatgtattcttattatcga |
7887889 |
T |
 |
| Q |
213 |
tatcaccaattcgtagttttttcatttgtctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
7887890 |
tatcaccaattcgtagttttttcatttgtttgtg |
7887923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 195 - 234
Target Start/End: Complemental strand, 16352788 - 16352749
Alignment:
| Q |
195 |
atgtattcttattatcgatatcaccaattcgtagtttttt |
234 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16352788 |
atgtattcttatcatcgatatcaccgattcgtagtttttt |
16352749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University