View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_170 (Length: 256)
Name: NF15941_low_170
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_170 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 32190933 - 32191171
Alignment:
| Q |
16 |
aaattggatgatcagaaggggttaggacagtatgttgataaggctgctgattatctgcatggttatcatcccaaaggtcatgatgcggccacgacacctc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32190933 |
aaattggatgatcagaaggggttaggacagtatgttgataaggctgctgattatctgcatggttatcatcccaaaggtcatgatgcggccacgactgctc |
32191032 |
T |
|
| Q |
116 |
caccttcttccaaaccggatcatcacaaaggtaatgatgcggaaaagtctga---------aggtggacatcatgggttaggtgatggtcttgctaaggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191033 |
caccttcttccaaaccggatcatcacaaaggtaatgatgcggaaaagtctgaaggtggaggaggtggacatcatgggttaggtgatggtcttgctaaggt |
32191132 |
T |
|
| Q |
207 |
tgctggaggcttctttaaatgataattcactgatttcat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191133 |
tgctggaggcttctttaaatgataattcactgatttcat |
32191171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 32210308 - 32210367
Alignment:
| Q |
16 |
aaattggatgatcagaaggggttaggacagtatgttgataaggctgctgattatctgcat |
75 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32210308 |
aaattggatgatcagaaaggtgtaggatcatatgttgataaagctgctgattatctgcat |
32210367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University