View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_176 (Length: 252)
Name: NF15941_low_176
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_176 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 55117356 - 55117577
Alignment:
| Q |
12 |
ttgtatattaaacccaatcctcctacttatatacgaatatcacgatctttacttaatttgggtattcannnnnnnnnnnnnnnnnnaactggattggata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55117356 |
ttgtatattaaacccaatcctcctacttatatacgaatatcacgatctttacttaatttgggtattcattttttatgtttttttttaactggattggata |
55117455 |
T |
 |
| Q |
112 |
tccgtggtgtgagactacaaagagtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacataacgttgctgca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55117456 |
tccgtggtgtgagactacaaagagtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacttaacgttgctgca |
55117555 |
T |
 |
| Q |
212 |
ttgtcattttaaatgagatatg |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55117556 |
ttgtcattttaaatgagatatg |
55117577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University