View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_187 (Length: 240)
Name: NF15941_low_187
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_187 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 32324737 - 32324956
Alignment:
| Q |
21 |
tgtgctttacgctatatacatatatagtttggtgaatttcttaacttgtaaatgcatttgcaaaaatagctccaacttttcaaccatgtgccaataatca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32324737 |
tgtgctttacgctatatacatatatagtttggtgaatttcttaacttgtaaatgcatttgcaaaaatagctccaacttttcaaccatgtgccaataatca |
32324836 |
T |
|
| Q |
121 |
atatttttcactataagtatcagtgtatcacatacatatataattagcaaacataagcgcactaggtagtggctactatatatatcattataatgaagct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32324837 |
atatttttcactataagtatcagtgtatcacatacatatataattagcaaacataagcgcactaggtagtggctactatatatatcattataatgaagct |
32324936 |
T |
|
| Q |
221 |
aataaactagctagactaaa |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32324937 |
aataaactagctagactaaa |
32324956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University