View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_192 (Length: 238)
Name: NF15941_low_192
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_192 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 20726126 - 20726346
Alignment:
| Q |
1 |
ccattagaccaagtgtaattagcacccttattagggagatgaatatggttgttattatcagtccaagcttgaaaatcatgcatatgagatttaataggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20726126 |
ccattagaccaagtgtaattagcaaccttggtagggatatgaataaggttgttattatcagtccaagcttgaaaatcatgcatatgagatttaataggtt |
20726225 |
T |
|
| Q |
101 |
gaaagttgcttctttgctcatgaacaccaaggatagcattgaaatctcctaaacaacaccaaggcaaagtagaagaatgttgaatacttatcagagaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20726226 |
gaaagttgcttctttgctcatgaacacgaaggatagcattgaaatctcctaaacaacaccaaggcaaagtagaagaatgttgaatacttatcagagaatc |
20726325 |
T |
|
| Q |
201 |
ccacataaacctccttctgat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20726326 |
ccacataaacctccttctgat |
20726346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University