View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_194 (Length: 238)
Name: NF15941_low_194
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_194 |
 | |
|
| [»] scaffold0067 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0067 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 36524 - 36732
Alignment:
| Q |
14 |
tctcttattaattactttggctgctgtttttatcatttatattctgcggattatatacaggtatgaacttagactctgaataattcaattttgtttgaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524 |
tctcttattaattactttggctgctgtttttatcatttatattctgcggattatatacaggtatgaacttagactctgaataattcaattttgtttgaat |
36623 |
T |
|
| Q |
114 |
aaaattgaaaccccatttgaaagttatgtgcttaaatgtcattttggtgaatcttttctctgagttagttttcatgtgctttttctttcttctgttgttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36624 |
aaaattgaaaccccatttgaaagttatgtgcttaaatgtcattttggtgaatcttttctctgaggtagttttcatgtgctttttctttcttctgttgttg |
36723 |
T |
|
| Q |
214 |
aaatttagt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
36724 |
aaatttagt |
36732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University