View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_201 (Length: 235)
Name: NF15941_low_201
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_201 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 40212150 - 40211947
Alignment:
| Q |
18 |
atttctttattgtgtctttgattaagaattaatgaagccttaagatttgcaaagcttctcttagcacgcaagtgatgggtgatttgtataatatttatta |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40212150 |
atttctttattgtgtctttgattaggaattaatgaagccataagatttgcaaagcttctcttagcacgcaactgatgggtgatttgtataatatttatta |
40212051 |
T |
 |
| Q |
118 |
ttgttatattttgaaggtaaacagcttaatacagaatctgctgacatatcagattagtgataagagtttgattatgtagttttaagaaacgaagattaaa |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40212050 |
ttgttatattttgaaggtaaacaacttaatacataatctgc-gacatatcagattagtgataagagtttgattttgtagttttaagaaacgaagattaaa |
40211952 |
T |
 |
| Q |
218 |
tattt |
222 |
Q |
| |
|
||||| |
|
|
| T |
40211951 |
tattt |
40211947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University