View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_210 (Length: 229)
Name: NF15941_low_210
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_210 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 27 - 210
Target Start/End: Original strand, 45666256 - 45666439
Alignment:
| Q |
27 |
attgtcatcgccaatggctaaacatttctggcttttcattgcaataggacttgttatcatcaacttggtttatggtcaacaacatcacttcttcaatgaa |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666256 |
attgtcatcgccaatggctaaacttttctggcttttcattgcaataggacttgttatcatcaacttggtttatggtcaacaacatcacttcttcaatgaa |
45666355 |
T |
 |
| Q |
127 |
accgaagaactctttctgttagaggctcatgaacatgcaacatcctttcttgaggagggtaatggaaatcctcttctcgtagga |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666356 |
actgaagaactctttctgttagaggctcatgaacatgcagcatcctttcttgaggagggtaatggaaatcctcttctcgtagga |
45666439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University