View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_221 (Length: 221)
Name: NF15941_low_221
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_221 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 44476629 - 44476521
Alignment:
| Q |
16 |
aatatccaaaactcatttctgactaatgtatggtccgaccaannnnnnnngttaaacaagtataattagttgtattttcttgatgaaggtatagcacgat |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44476629 |
aatatccaaaactcgtttctgactaatgtatggtccgaccaattttttttgttaaacaagtataattagttgtatttttttgatgaaggtatagcacgat |
44476530 |
T |
 |
| Q |
116 |
acgagaaga |
124 |
Q |
| |
|
||||||| |
|
|
| T |
44476529 |
gtgagaaga |
44476521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 122 - 202
Target Start/End: Complemental strand, 44476374 - 44476297
Alignment:
| Q |
122 |
agaacagagatgatactaaaatttgttatattaaaaatattcttctagttctatgcaattaactaaaattagtgtccatat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44476374 |
agaacagagatgatactaaaatttgttatattaaaaata---ttctagttctatgcaattaactaaaattagtgtccatat |
44476297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 194
Target Start/End: Complemental strand, 44471777 - 44471720
Alignment:
| Q |
133 |
gatactaaaatttgttatattaaaaatattcttctagttctatgcaattaactaaaattagt |
194 |
Q |
| |
|
||||||| ||||||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
44471777 |
gatactagaatttgttatattaaaa----tattatagttctatgcaattaactaaaattagt |
44471720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University