View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_227 (Length: 216)
Name: NF15941_low_227
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_227 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 110 - 182
Target Start/End: Original strand, 12373568 - 12373640
Alignment:
| Q |
110 |
gtctgctgagttttgtccctaaattttttcaatttgtacaattaaatatctcatttccttttcataatatctt |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12373568 |
gtctgctgagttttgtccctaaaatttttcaatttgtacaattaaatatctcatttccttttcataatatctt |
12373640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 38 - 82
Target Start/End: Original strand, 12373498 - 12373542
Alignment:
| Q |
38 |
catgtttacttatatttttagttcctctaatttaactatgtgcaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12373498 |
catgtttacttatatttttagttcctctaatttaactatgtgcaa |
12373542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University