View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_low_229 (Length: 213)

Name: NF15941_low_229
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_low_229
NF15941_low_229
[»] chr3 (1 HSPs)
chr3 (13-198)||(43047502-43047687)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 43047502 - 43047687
Alignment:
13 gaaatgaagtaactgaatttttgtcttgtcnnnnnnnnccccctaaactgttgaagaaagaaaaagaaaacgctgtgaaccgttacacgtgttttgtgag 112  Q
    |||| |||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43047502 gaaaagaagtaactgaatttttgtcttgtcttttttttccccctaaactgttgaagaaagaaaaagaaaacgctgtgaaccgttacacgtgttttgtgag 43047601  T
113 ttaattaaaatgagggatatttttacggatttaaggattaaagatgagttttttgaaatgaaatttgaaaaattgaagttggtttt 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43047602 ttaattaaaatgagggatatttttacggatttaaggattaaagatgagttttttgaaatgaaatttgaaaaattgaagttggtttt 43047687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University