View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_low_235 (Length: 204)

Name: NF15941_low_235
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_low_235
NF15941_low_235
[»] chr2 (1 HSPs)
chr2 (71-187)||(38748945-38749061)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 71 - 187
Target Start/End: Complemental strand, 38749061 - 38748945
Alignment:
71 tgcaatgtatcaaagtacattgcatggacacctctttgtgtattctatacataaaattctatatatcgtgatctagaattttcatgtcacccaaaaccaa 170  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38749061 tgcaatgtatcaaagtacatttcatggacacctctttgtgtattctatacataaaattctatatatcgtgatctagaattttcatgtcacccaaaaccaa 38748962  T
171 aaaggcacggatattgt 187  Q
    || ||||||||||||||    
38748961 aagggcacggatattgt 38748945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University