View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_235 (Length: 204)
Name: NF15941_low_235
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_235 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 71 - 187
Target Start/End: Complemental strand, 38749061 - 38748945
Alignment:
| Q |
71 |
tgcaatgtatcaaagtacattgcatggacacctctttgtgtattctatacataaaattctatatatcgtgatctagaattttcatgtcacccaaaaccaa |
170 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38749061 |
tgcaatgtatcaaagtacatttcatggacacctctttgtgtattctatacataaaattctatatatcgtgatctagaattttcatgtcacccaaaaccaa |
38748962 |
T |
|
| Q |
171 |
aaaggcacggatattgt |
187 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
38748961 |
aagggcacggatattgt |
38748945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University