View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15941_low_87 (Length: 348)

Name: NF15941_low_87
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15941_low_87
NF15941_low_87
[»] chr4 (3 HSPs)
chr4 (195-246)||(25399985-25400036)
chr4 (76-110)||(25400120-25400154)
chr4 (13-47)||(25400183-25400217)


Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 195 - 246
Target Start/End: Complemental strand, 25400036 - 25399985
Alignment:
195 acaattaaattcaaatggtattgagaaagtaactcaaaattgaagcttgatg 246  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
25400036 acaattaaattcaaagggtattgagaaagtaactcaaaattgaagcttgatg 25399985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 25400154 - 25400120
Alignment:
76 catttctattaattcttttattgtcttgagtggaa 110  Q
    |||||||||||||||||||||||||||||||||||    
25400154 catttctattaattcttttattgtcttgagtggaa 25400120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 25400217 - 25400183
Alignment:
13 aatattcagaggaaggtttctagtttcaccatcga 47  Q
    |||||||||||||||||||||||||||||||||||    
25400217 aatattcagaggaaggtttctagtttcaccatcga 25400183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University