View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_87 (Length: 348)
Name: NF15941_low_87
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 195 - 246
Target Start/End: Complemental strand, 25400036 - 25399985
Alignment:
| Q |
195 |
acaattaaattcaaatggtattgagaaagtaactcaaaattgaagcttgatg |
246 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400036 |
acaattaaattcaaagggtattgagaaagtaactcaaaattgaagcttgatg |
25399985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 25400154 - 25400120
Alignment:
| Q |
76 |
catttctattaattcttttattgtcttgagtggaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400154 |
catttctattaattcttttattgtcttgagtggaa |
25400120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 25400217 - 25400183
Alignment:
| Q |
13 |
aatattcagaggaaggtttctagtttcaccatcga |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400217 |
aatattcagaggaaggtttctagtttcaccatcga |
25400183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University