View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15941_low_93 (Length: 329)
Name: NF15941_low_93
Description: NF15941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15941_low_93 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 7 - 321
Target Start/End: Original strand, 45088789 - 45089103
Alignment:
| Q |
7 |
atatatgggaacaatgagaagggaatgggtagagtaaggacattcaaagagggaaagctgaagatctcagaagatgggcttcttgagcatgatgagaaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088789 |
atatatgggaacaatgagaagggaatgggcagagtaaggacattcaaagagggaaagctgaagatctcagaagatgggcttcttgagcatgatgagaaag |
45088888 |
T |
 |
| Q |
107 |
gtattcccgtatccggcgatgttcgaaattcatgggctggttattcccttctgcaggctttgtttatcaaagagcacaatgcagtatgtgacatgctaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088889 |
gtattcccgtatccggcgatgttcgaaattcatgggctggttattcccttctgcaggctttgtttatcaaagagcacaatgcagtatgtgacatgctaaa |
45088988 |
T |
 |
| Q |
207 |
agtaagccaaattattttcatctgttgcataacttggctccattttttgcctcggaaattaatgtgcagttttatgttctttgcttataggagcactatc |
306 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088989 |
agtaagtcaaattattttcatctgttgcataatttggctccattttttgcctcggaaattaatgtgcagttttatgttctttgcttataggagcactatc |
45089088 |
T |
 |
| Q |
307 |
ctgattttgatgatg |
321 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45089089 |
ctgattttgatgatg |
45089103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University