View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15942_high_3 (Length: 420)
Name: NF15942_high_3
Description: NF15942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15942_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 19 - 405
Target Start/End: Complemental strand, 2930827 - 2930441
Alignment:
| Q |
19 |
gttatatatgaagatgaagaaacagaggatattatttctaatgagaattgtgttgctggaattttgagacactcttcactgtcacgttattatcctgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930827 |
gttatatatgaagatgaagaaacagaggatattatttctaatgagaattgtgttgctggaattttgagacactcttcactgtcacgttattatcctgagt |
2930728 |
T |
|
| Q |
119 |
ctgattcggatagttcttcggagaatgagtttccggcgatggagaactgggactcacccgggaatatgagtttccagtgggatgaagaagatagagacgg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2930727 |
ctgattcggatagttcttcggagaatgagtttccggcgatggagaactgggactcacccgggaatatgagtttccggtgggatgaagaagatagagacgg |
2930628 |
T |
|
| Q |
219 |
gttaattgagatagctcttgatggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930627 |
gttaattgagatagctcttgatggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgc |
2930528 |
T |
|
| Q |
319 |
agggagttttccggcgaggaggaggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtatt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930527 |
agggagttttccggcgaggaggaggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtatt |
2930441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 36117417 - 36117473
Alignment:
| Q |
98 |
tgtcacgttattatcctgagtctgattcggatagttcttcggagaatgagtttccgg |
154 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||| || |||||| |||||||||||| |
|
|
| T |
36117417 |
tgtcacgttactatccggaatctgattcggatagctcctcggaggatgagtttccgg |
36117473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 313
Target Start/End: Original strand, 36117578 - 36117626
Alignment:
| Q |
265 |
tttcagtatgaggaagagaatatgattgaaattgatatttctccgacga |
313 |
Q |
| |
|
|||||||| || ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36117578 |
tttcagtacgaagaagagaatttgattgagattgatatttctccgacga |
36117626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University