View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15942_low_4 (Length: 423)
Name: NF15942_low_4
Description: NF15942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15942_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 55438138 - 55438398
Alignment:
| Q |
18 |
taacagtggtgaggagaaaggcagctccgattacagttgcccatacaggaggcgagtaaaccaattccgtcatattctattcttcttctatttgaacatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55438138 |
taacagtggtgaggagaaaggcagctccgattacagttgcccatacaggaggcgagtaaaccaattccgtcatattctattcttcttctatttgaacatt |
55438237 |
T |
 |
| Q |
118 |
atacttattattccaaaattcacctcgtcacctgtttgaacatgttagttagtgatatcaaaatcgcaatcagaatcagaatcggaatcgggagtcaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55438238 |
atacttattattccaaaattcacctcgtcacctgtttgaacatgttagttagtgatatcaaaatcgcaatcagaatca------gaatcgggagtcaaca |
55438331 |
T |
 |
| Q |
218 |
tatacttaccttaacagagattgattgatatcggatgaaatgatagatatgaacgatccgcgacacc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55438332 |
tatacttaccttaacagagattgattgatattggatgaaatgatagatatgaacgatccgcgacacc |
55438398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 340 - 408
Target Start/End: Original strand, 55438454 - 55438522
Alignment:
| Q |
340 |
cagttacttattaggtcaaccttatcctccgtcgtcgtcaactcttcctttccttttcgcaacccacct |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55438454 |
cagttacttattaggtcaaccttatcctccgtcgtcgtcaactcttcctttccttttcgcaacccacct |
55438522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University