View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15943_low_7 (Length: 261)
Name: NF15943_low_7
Description: NF15943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15943_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 40695958 - 40695713
Alignment:
| Q |
1 |
cgttccatcatccaaggcatacaatccacatacaacaaggtattatgattaacttgttttgagttttgacataatttatgtgaaataatgcttataagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
40695958 |
cgttccatcatccaaggcatacaatccacatacaacaaggtattatgattaacttgttttgagttgtgacataatttatttgaaataatgcttataagct |
40695859 |
T |
 |
| Q |
101 |
aatatgagttattcattttgtgtttttctttgtaaata-ttaacaataggtctctacttgttatgatcaccactgccatgtgtttcatctgcattggttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40695858 |
aatatgagttattcattttgtgtttttctttgtaaatatttaacaacaggtctctacttgctatgatcaccactgccatgtgtttcatctgcattggttt |
40695759 |
T |
 |
| Q |
200 |
ccattgaaaagatgcaccttttgttaaggaggttggagatatgtag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40695758 |
ccattgaaaagatgcaccttttgttaaggagattggagatatgtag |
40695713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University